Transcript: Mouse NM_001033533.3

Mus musculus coiled-coil domain containing 102A (Ccdc102a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccdc102a (234582)
Length:
2309
CDS:
262..1911

Additional Resources:

NCBI RefSeq record:
NM_001033533.3
NBCI Gene record:
Ccdc102a (234582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346825 TTAGCCAATGGAAGATCAAAT pLKO_005 1118 CDS 100% 13.200 18.480 N Ccdc102a n/a
2 TRCN0000181620 GAAGATTCGTAGTACCCGATT pLKO.1 1818 CDS 100% 4.050 5.670 N Ccdc102a n/a
3 TRCN0000346822 GAAGATTCGTAGTACCCGATT pLKO_005 1818 CDS 100% 4.050 5.670 N Ccdc102a n/a
4 TRCN0000177881 CTTAGCCAATGGAAGATCAAA pLKO.1 1117 CDS 100% 5.625 4.500 N Ccdc102a n/a
5 TRCN0000363874 GGAGCCTGTTGGATATGTATA pLKO_005 2090 3UTR 100% 13.200 9.240 N Ccdc102a n/a
6 TRCN0000177791 CAAACAACTCAGCATCCTAAA pLKO.1 1173 CDS 100% 10.800 7.560 N Ccdc102a n/a
7 TRCN0000346824 GGCTAGATGAGTCCCAGAAAG pLKO_005 1031 CDS 100% 10.800 7.560 N Ccdc102a n/a
8 TRCN0000182453 GCTAGATGAGTCCCAGAAAGT pLKO.1 1032 CDS 100% 4.950 3.465 N Ccdc102a n/a
9 TRCN0000198246 GAAGATCAAATACGAGGAGTT pLKO.1 1128 CDS 100% 4.050 2.835 N Ccdc102a n/a
10 TRCN0000182802 CCTGCTTCAAACCACTTCCTT pLKO.1 2022 3UTR 100% 3.000 2.100 N Ccdc102a n/a
11 TRCN0000181876 GAAGCAGTTTCAAGAGAAGGT pLKO.1 1545 CDS 100% 2.640 1.848 N Ccdc102a n/a
12 TRCN0000346823 CCAAGCAGGAGATGCTCAAAC pLKO_005 1157 CDS 100% 10.800 6.480 N Ccdc102a n/a
13 TRCN0000182321 GAGAAGAACAAGGAACTGGCA pLKO.1 1495 CDS 100% 0.660 0.396 N Ccdc102a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477301 TCTGAATATCTTACGAAATCTAGC pLX_317 14.2% 85.8% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV