Transcript: Mouse NM_001033537.2

Mus musculus post-GPI attachment to proteins 3 (Pgap3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pgap3 (320655)
Length:
2424
CDS:
96..1058

Additional Resources:

NCBI RefSeq record:
NM_001033537.2
NBCI Gene record:
Pgap3 (320655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184722 CCATTTCGACTACGGCTACAA pLKO.1 746 CDS 100% 4.950 6.930 N Pgap3 n/a
2 TRCN0000184025 CACATATCCTACCTGAGCCTT pLKO.1 723 CDS 100% 2.640 3.696 N Pgap3 n/a
3 TRCN0000196132 GAGATGAACATGCACCGGATA pLKO.1 1794 3UTR 100% 4.050 3.240 N Pgap3 n/a
4 TRCN0000184795 CCCTTTGCACTCCACTCAAAT pLKO.1 1976 3UTR 100% 13.200 9.240 N Pgap3 n/a
5 TRCN0000217898 GACTGCAAGTATGAGTGTATG pLKO.1 294 CDS 100% 10.800 7.560 N Pgap3 n/a
6 TRCN0000216748 GTCATCCTGCATTCTGTTTAC pLKO.1 618 CDS 100% 10.800 7.560 N Pgap3 n/a
7 TRCN0000195766 CAGCCAATCTACATGAGCCTA pLKO.1 252 CDS 100% 2.640 1.848 N Pgap3 n/a
8 TRCN0000179921 CCTGGTTCTTTATCTTGGGAT pLKO.1 2092 3UTR 100% 2.640 1.848 N Pgap3 n/a
9 TRCN0000216660 CCATGTTCAAGCTGGACTAAA pLKO.1 1039 CDS 100% 13.200 7.920 N Pgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04598 pDONR223 100% 85.7% 85% None (many diffs) n/a
2 ccsbBroad304_04598 pLX_304 0% 85.7% 85% V5 (many diffs) n/a
3 TRCN0000465222 ACGCATCCCATACATCCGCCCGGC pLX_317 22.3% 85.7% 85% V5 (many diffs) n/a
Download CSV