Construct: ORF TRCN0000465222
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016531.1_s317c1
- Derived from:
- ccsbBroadEn_04598
- DNA Barcode:
- ACGCATCCCATACATCCGCCCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PGAP3 (93210)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465222
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_033419.5 | 100% | 100% | |
2 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_001291728.1 | 93.4% | 93.4% | 431_432ins63 |
3 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_001291726.1 | 84% | 84% | 278_279ins153 |
4 | human | 93210 | PGAP3 | post-GPI attachment to prot... | XM_011525480.2 | 75.3% | 72.8% | 693_694ins205;723_724ins32 |
5 | human | 93210 | PGAP3 | post-GPI attachment to prot... | XR_934601.1 | 67.2% | 1_43del;474_615del;955_956ins190 | |
6 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_001291730.1 | 64.3% | 64.3% | 553_554ins342 |
7 | human | 93210 | PGAP3 | post-GPI attachment to prot... | XM_011525481.2 | 61.8% | 57.5% | (many diffs) |
8 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_001291732.1 | 57.8% | 57.8% | 431_432ins63;490_491ins342 |
9 | human | 93210 | PGAP3 | post-GPI attachment to prot... | NM_001291733.1 | 45.8% | 45.3% | (many diffs) |
10 | human | 93210 | PGAP3 | post-GPI attachment to prot... | XR_002958086.1 | 30.2% | (many diffs) | |
11 | mouse | 320655 | Pgap3 | post-GPI attachment to prot... | NM_001033537.2 | 85.7% | 85% | (many diffs) |
12 | mouse | 320655 | Pgap3 | post-GPI attachment to prot... | XM_006533550.3 | 67.1% | 66.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1026
- ORF length:
- 960
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cggcctggcg gcgcggttgg tcctgctagc tggggcagcg gcgctggcga 121 gcggctccca gggcgaccgt gagccggtgt accgcgactg cgtactgcag tgcgaagagc 181 agaactgctc tgggggcgct ctgaatcact tccgctcccg ccagccaatc tacatgagtc 241 tagcaggctg gacctgtcgg gacgactgta agtatgagtg tatgtgggtc accgttgggc 301 tctacctcca ggaaggtcac aaagtgcctc agttccatgg caagtggccc ttctcccggt 361 tcctgttctt tcaagagccg gcatcggccg tggcctcgtt tctcaatggc ctggccagcc 421 tggtgatgct ctgccgctac cgcaccttcg tgccagcctc ctcccccatg taccacacct 481 gtgtggcctt cgcctgggtg tccctcaatg catggttctg gtccacagtt ttccacacca 541 gggacactga cctcacagag aaaatggact acttctgtgc ctccactgtc atcctacact 601 caatctacct gtgctgcgtc aggaccgtgg ggctgcagca cccagctgtg gtcagtgcct 661 tccgggctct cctgctgctc atgctgaccg tgcacgtctc ctacctgagc ctcatccgct 721 tcgactatgg ctacaacctg gtggccaacg tggctattgg cctggtcaac gtggtgtggt 781 ggctggcctg gtgcctgtgg aaccagcggc ggctgccTCA CGTGCGCAAG TGCGTGGTGG 841 TGGTCTTGCT GCTGCAGGGG CTGTCCCTGC TCGAGCTGCT TGACTTCCCA CCGCTCTTCT 901 GGGTCCTGGA TGCCCATGCC ATCTGGCACA TCAGCACCAT CCCTGTCCAC GTCCTCTTTT 961 TCAGCTTTCT GGAAGATGAC AGCCTGTACC TGCTGAAGGA ATCAGAGGAC AAGTTCAAGC 1021 TGGACTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACGCATCCC ATACATCCGC CCGGCACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt