Transcript: Human NM_001033560.1

Homo sapiens dynein axonemal assembly factor 4 (DNAAF4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
DNAAF4 (161582)
Length:
1807
CDS:
369..1514

Additional Resources:

NCBI RefSeq record:
NM_001033560.1
NBCI Gene record:
DNAAF4 (161582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143888 CCAGAATGGTTGAAGGATAAA pLKO.1 1236 CDS 100% 13.200 6.600 Y DNAAF4 n/a
2 TRCN0000140714 GACGGGTGTTGACAAAGAGAT pLKO.1 632 CDS 100% 4.950 2.475 Y DNAAF4 n/a
3 TRCN0000143792 GCCTGGAAAGAATATCAAAGA pLKO.1 849 CDS 100% 4.950 2.475 Y DNAAF4 n/a
4 TRCN0000141494 CGTGAATCACAAGTAGCAGAA pLKO.1 1122 CDS 100% 4.050 2.025 Y DNAAF4 n/a
5 TRCN0000143387 GCATTTCTTTATGCTCCCATA pLKO.1 519 CDS 100% 4.050 2.025 Y DNAAF4 n/a
6 TRCN0000141967 GCATCTAGAAATCTTGCTCCA pLKO.1 981 CDS 100% 2.160 1.080 Y DNAAF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09736 pDONR223 100% 99.8% 99.4% None 572A>G;995C>T n/a
2 ccsbBroad304_09736 pLX_304 0% 99.8% 99.4% V5 572A>G;995C>T n/a
3 TRCN0000468127 GGCATTTACGATATTGCCTGAGTT pLX_317 33.9% 99.8% 99.4% V5 572A>G;995C>T n/a
Download CSV