Transcript: Human NM_001033602.3

Homo sapiens microtubule associated scaffold protein 2 (MTUS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
MTUS2 (23281)
Length:
7093
CDS:
243..4352

Additional Resources:

NCBI RefSeq record:
NM_001033602.3
NBCI Gene record:
MTUS2 (23281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147784 GCACCGATATGTGTGTATATT pLKO.1 4692 3UTR 100% 15.000 21.000 N MTUS2 n/a
2 TRCN0000130434 GCAAAGTGCGAGAAACTACAA pLKO.1 3438 CDS 100% 4.950 6.930 N MTUS2 n/a
3 TRCN0000149753 GCTGTCAATCGAACTTGCAAA pLKO.1 3389 CDS 100% 4.950 6.930 N MTUS2 n/a
4 TRCN0000129311 CGATTAAACTCTCGCCCACAT pLKO.1 4264 CDS 100% 4.050 5.670 N MTUS2 n/a
5 TRCN0000129063 GAAGACCTCAAAGCAAGGATT pLKO.1 4095 CDS 100% 4.950 3.465 N MTUS2 n/a
6 TRCN0000129310 CGAACCAATGAAGAGCTGCTT pLKO.1 4212 CDS 100% 2.640 1.848 N MTUS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02744 pDONR223 100% 24.8% 24.3% None (many diffs) n/a
2 ccsbBroad304_02744 pLX_304 0% 24.8% 24.3% V5 (many diffs) n/a
3 TRCN0000474380 TAGAGCGGAGGTTATATGCCAATG pLX_317 45% 24.8% 24.3% V5 (many diffs) n/a
Download CSV