Construct: ORF TRCN0000474380
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018426.1_s317c1
- Derived from:
- ccsbBroadEn_02744
- DNA Barcode:
- TAGAGCGGAGGTTATATGCCAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTUS2 (23281)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474380
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23281 | MTUS2 | microtubule associated scaf... | NM_015233.6 | 100% | 100% | |
| 2 | human | 23281 | MTUS2 | microtubule associated scaf... | XM_011535022.2 | 58.9% | 57.8% | (many diffs) |
| 3 | human | 23281 | MTUS2 | microtubule associated scaf... | XM_024449335.1 | 58.9% | 57.8% | (many diffs) |
| 4 | human | 23281 | MTUS2 | microtubule associated scaf... | NM_001366651.1 | 26.1% | 25.5% | (many diffs) |
| 5 | human | 23281 | MTUS2 | microtubule associated scaf... | NM_001366650.1 | 24.8% | 24.3% | (many diffs) |
| 6 | human | 23281 | MTUS2 | microtubule associated scaf... | NM_001033602.3 | 24.8% | 24.3% | (many diffs) |
| 7 | human | 23281 | MTUS2 | microtubule associated scaf... | XM_011535020.3 | 24.6% | 24.1% | (many diffs) |
| 8 | human | 23281 | MTUS2 | microtubule associated scaf... | XM_011535019.3 | 24.3% | 23.7% | (many diffs) |
| 9 | mouse | 77521 | Mtus2 | microtubule associated tumo... | XM_006504894.3 | 83% | 89.1% | (many diffs) |
| 10 | mouse | 77521 | Mtus2 | microtubule associated tumo... | XM_006504891.3 | 50.6% | 52.2% | (many diffs) |
| 11 | mouse | 77521 | Mtus2 | microtubule associated tumo... | NM_029920.7 | 21.7% | 22.5% | (many diffs) |
| 12 | mouse | 77521 | Mtus2 | microtubule associated tumo... | XM_006504890.3 | 21.7% | 22.5% | (many diffs) |
| 13 | mouse | 77521 | Mtus2 | microtubule associated tumo... | XM_011241018.2 | 19.7% | 20.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1110
- ORF length:
- 1044
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ccattgctgc tgcaagcctt ataactgcct tcagtgcctg gacaagacga 121 atgaaagtgc ccttgtgaaa gaaaaagagc tgtcaatcga acttgcaaac atcagggatg 181 aagttgcctt ccatacagca aagtgcgaga aactacaaaa ggagaaggag gagctggaga 241 ggcggttcga ggacgaggtg aagaggctgg gctggcagca gcaggccgag ctccaggagc 301 tggaggagcg gctgcagctg caattcgagg cggaaatggc gcgcctgcag gaggagcacg 361 gtgaccagct gctgagcatc cggtgtcaac accaggagca ggtggaagat ctcaccgcca 421 gccatgatgc tgctctccta gagatggaaa ataaccacac agttgccatc acaatcctgc 481 aggatgacca cgaccacaaa gtccaagaat tgatgtccac tcatgagctt gaaaagaaag 541 aattggaaga aaattttgaa aaactgcggc tgtcattgca ggaccaggtg gacacgctga 601 ccttccagag ccagtctctg cgggacagag cccgccgctt cGAAGAGGCC TTGAGGAAGA 661 ACACAGAGGA GCAGCTGGAG ATTGCATTGG CTCCTTATCA GCACTTGGAA GAAGACATGA 721 AGAGTCTGAA GCAGGTATTA GAAATGAAGA ATCAGCAAAT ACACGAGCAA GAAAAGAAGA 781 TTCTTGAGCT GGAAAAGCTG GCAGAAAAGA ACATTATCCT AGAAGAAAAG ATCCAGGTTC 841 TCCAACAGCA GAACGAAGAC CTCAAAGCAA GGATTGACCA AAACACAGTT GTCACCAGAC 901 AGCTGTCGGA GGAAAATGCT AACCTCCAGG AATATGTTGA GAAGGAAACC CAGGAGAAGA 961 AGAGATTGAG CCGAACCAAT GAAGAGCTGC TTTGGAAGCT CCAAACTGGG GACCCGACCA 1021 GTCCGATTAA ACTCTCGCCC ACATCTCCCG TTTACCGCGG CTCCTCCTCG GGGCCCTCCT 1081 CTCCGGCCAG AGTCAGCACA ACACCCAGAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1141 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1201 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATAGAG 1261 CGGAGGTTAT ATGCCAATGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1321 tgaaagatt