Transcript: Mouse NM_001034856.2

Mus musculus B cell translocation gene 1, anti-proliferative, pseudogene 2 (Btg1-ps2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Btg1-ps2 (194735)
Length:
1194
CDS:
561..1046

Additional Resources:

NCBI RefSeq record:
NM_001034856.2
NBCI Gene record:
Btg1-ps2 (194735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087901 CGCATCAACCATAAGATGGAT pLKO.1 741 CDS 100% 3.000 1.500 Y Btg1-ps2 n/a
2 TRCN0000007625 CACTACAAACACCACTGGTTT pLKO.1 681 CDS 100% 4.950 2.475 Y BTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00179 pDONR223 100% 80.9% 78.3% None (many diffs) n/a
2 ccsbBroad304_00179 pLX_304 98.3% 80.9% 78.3% V5 (many diffs) n/a
3 TRCN0000475091 CTTGGACATTTAAAAGATAACAGT pLX_317 48.5% 80.7% 77.7% V5 (many diffs) n/a
Download CSV