Construct: ORF TRCN0000475091
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010442.1_s317c1
- Derived from:
- ccsbBroadEn_00179
- DNA Barcode:
- CTTGGACATTTAAAAGATAACAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BTG1 (694)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475091
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 694 | BTG1 | BTG anti-proliferation fact... | NM_001731.3 | 99.8% | 99.4% | 511G>A |
| 2 | mouse | 12226 | Btg1 | B cell translocation gene 1... | NM_007569.2 | 96.6% | 99.4% | (many diffs) |
| 3 | mouse | 436199 | Btg1-ps1 | B cell translocation gene 1... | XM_006541512.2 | 83.1% | 80.5% | (many diffs) |
| 4 | mouse | 436199 | Btg1-ps1 | B cell translocation gene 1... | NM_001243943.1 | 81.5% | 80.1% | (many diffs) |
| 5 | mouse | 436199 | Btg1-ps1 | B cell translocation gene 1... | XM_006541513.2 | 81.5% | 80.1% | (many diffs) |
| 6 | mouse | 194735 | Btg1-ps2 | B cell translocation gene 1... | NM_001034856.2 | 80.7% | 77.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 579
- ORF length:
- 513
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tcccttctac acccgggccg ccaccatgat aggcgagatc gccgccgccg 121 tgtccttcat ctccaagttt ctccgcacca aggggctcac gagcgagcga cagctgcaga 181 ccttcagcca gagcctgcag gagctgctgg cagaacatta taaacatcac tggttcccag 241 aaaagccatg caagggatcg ggttaccgtt gtattcgcat caaccataaa atggatcctc 301 tgattggaca ggcagcacag cggattggac TGAGCAGTCA GGAGCTGTTC AGGCTTCTCC 361 CAAGTGAACT CACACTCTGG GTTGACCCCT ATGAAGTGTC CTACAGAATT GGAGAGGATG 421 GCTCCATCTG TGTGCTGTAT GAAGCCTCAC CAGCAGGAGG TAGCACTCAA AACAGCACCA 481 ACGTGCAAAT GGTAGACAGC CGAATCAGCT GTAAGGAGGA ACTTCTCTTG GGCAGAACGA 541 GCCCTTCCAA AAACTACAAT ATGATGACTG TATCAAGTTA CCCAACTTTC TTGTACAAAG 601 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 661 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 721 ACGACTTGGA CATTTAAAAG ATAACAGTAC GCGTTAAGTC gacaatcaac ctctggatta 781 caaaatttgt gaaagatt