Transcript: Human NM_001035223.4

Homo sapiens ral guanine nucleotide dissociation stimulator like 3 (RGL3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RGL3 (57139)
Length:
2511
CDS:
37..2169

Additional Resources:

NCBI RefSeq record:
NM_001035223.4
NBCI Gene record:
RGL3 (57139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001035223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047408 CCGCTATCTACTTTCAGGAAA pLKO.1 1141 CDS 100% 4.950 6.930 N RGL3 n/a
2 TRCN0000047411 GAACCTGTATCGAAGCATCTT pLKO.1 1914 CDS 100% 4.950 6.930 N RGL3 n/a
3 TRCN0000047409 CGAGCCTTGCAGAAGCACAAT pLKO.1 1972 CDS 100% 4.950 3.960 N RGL3 n/a
4 TRCN0000047412 GTGCTCCTGATTCCTGACAAT pLKO.1 2050 CDS 100% 4.950 3.465 N RGL3 n/a
5 TRCN0000047410 CCTCATAGACTTGGAGCTCTT pLKO.1 804 CDS 100% 4.050 2.835 N RGL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08706 pDONR223 100% 99.7% 99.5% None (many diffs) n/a
2 ccsbBroad304_08706 pLX_304 0% 99.7% 99.5% V5 (many diffs) n/a
3 TRCN0000476465 AACTACCTTTACTTAAACACAGAT pLX_317 16.1% 99.7% 99.5% V5 (many diffs) n/a
Download CSV