Transcript: Mouse NM_001035854.2

Mus musculus adaptor-related protein complex 2, beta 1 subunit (Ap2b1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ap2b1 (71770)
Length:
5411
CDS:
165..3020

Additional Resources:

NCBI RefSeq record:
NM_001035854.2
NBCI Gene record:
Ap2b1 (71770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001035854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311180 ACCGCCAAGGGCATATCTATA pLKO_005 2398 CDS 100% 13.200 18.480 N Ap2b1 n/a
2 TRCN0000100497 CGCAAACACTTGCCAATTCAT pLKO.1 1932 CDS 100% 5.625 4.500 N Ap2b1 n/a
3 TRCN0000302691 CGCAAACACTTGCCAATTCAT pLKO_005 1932 CDS 100% 5.625 4.500 N Ap2b1 n/a
4 TRCN0000100499 GCAGCTATGATTTGGATTGTA pLKO.1 1500 CDS 100% 5.625 4.500 N Ap2b1 n/a
5 TRCN0000100496 CCCAACAAGTATGAAAGTATT pLKO.1 1428 CDS 100% 13.200 9.240 N Ap2b1 n/a
6 TRCN0000304939 AGTGGTGCTTTCAGCCGTAAA pLKO_005 926 CDS 100% 10.800 7.560 N Ap2b1 n/a
7 TRCN0000382404 ATATGCTGAAAGAATCGATAA pLKO_005 1526 CDS 100% 10.800 7.560 N Ap2b1 n/a
8 TRCN0000100495 CCAGTCATCTTGTGCTGACAT pLKO.1 3135 3UTR 100% 4.950 3.465 N Ap2b1 n/a
9 TRCN0000302759 CCAGTCATCTTGTGCTGACAT pLKO_005 3135 3UTR 100% 4.950 3.465 N Ap2b1 n/a
10 TRCN0000150775 GAAGAAAGTGATTGCTGCTAT pLKO.1 266 CDS 100% 4.950 3.465 N AP2B1 n/a
11 TRCN0000100498 GCCATCCAGTTTAACAAGAAT pLKO.1 2466 CDS 100% 5.625 3.375 N Ap2b1 n/a
12 TRCN0000302692 GCCATCCAGTTTAACAAGAAT pLKO_005 2466 CDS 100% 5.625 3.375 N Ap2b1 n/a
13 TRCN0000152841 GCTTGATCTAATCCAGACCAA pLKO.1 1349 CDS 100% 2.640 1.584 N AP2B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05789 pDONR223 100% 92.5% 99.8% None (many diffs) n/a
2 ccsbBroad304_05789 pLX_304 0% 92.5% 99.8% V5 (many diffs) n/a
3 TRCN0000479045 CGAGCACTCCCATAGAACCCCGCG pLX_317 13.3% 92.5% 99.8% V5 (many diffs) n/a
Download CSV