Transcript: Mouse NM_001037166.2

Mus musculus predicted gene 4925 (Gm4925), mRNA.

Source:
NCBI, updated 2014-02-27
Taxon:
Mus musculus (mouse)
Gene:
Gm4925 (237433)
Length:
1561
CDS:
386..784

Additional Resources:

NCBI RefSeq record:
NM_001037166.2
NBCI Gene record:
Gm4925 (237433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346318 CTAAGATTTAGTCTAGCATTA pLKO_005 974 3UTR 100% 10.800 15.120 N Gm4925 n/a
2 TRCN0000346260 CACCAGATCAACCTAATTAAG pLKO_005 599 CDS 100% 13.200 10.560 N Gm4925 n/a
3 TRCN0000346317 TTGCATCCAATTGTGATAAAC pLKO_005 540 CDS 100% 13.200 10.560 N Gm4925 n/a
4 TRCN0000346259 CTCAGGCGAAAGATGTCATTG pLKO_005 738 CDS 100% 10.800 7.560 N Gm4925 n/a
5 TRCN0000376304 GGAAACCTCGGAAAGTGATAG pLKO_005 678 CDS 100% 10.800 7.560 N Gm4925 n/a
6 TRCN0000376305 GGCCTGCATTACTAGGGTTTA pLKO_005 1153 3UTR 100% 10.800 7.560 N Gm4925 n/a
7 TRCN0000376306 TGTACATCAAGTTGGTGGAAA pLKO_005 564 CDS 100% 4.950 2.970 N Gm4925 n/a
8 TRCN0000303318 CGAAGCTGCCAAAGCCTTAGA pLKO_005 493 CDS 100% 4.950 2.475 Y RPS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13948 pDONR223 100% 86.4% 88.6% None (many diffs) n/a
2 ccsbBroad304_13948 pLX_304 0% 86.4% 88.6% V5 (many diffs) n/a
3 TRCN0000466110 TACGGTTTCCTATGTTTGGATCTT pLX_317 92% 86.4% 88.6% V5 (many diffs) n/a
Download CSV