Transcript: Human NM_001037343.1

Homo sapiens cyclin dependent kinase like 5 (CDKL5), transcript variant II, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
CDKL5 (6792)
Length:
3430
CDS:
250..3342

Additional Resources:

NCBI RefSeq record:
NM_001037343.1
NBCI Gene record:
CDKL5 (6792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147626 TTGCGGAGCCCAGTACCAGT pXPR_003 AGG 1539 50% 13 0.9699 CDKL5 CDKL5 77196
2 BRDN0001146505 GACTAAGACTAGCTCCAGCA pXPR_003 AGG 1115 36% 13 0.8599 CDKL5 CDKL5 77195
3 BRDN0001144890 AAAGTCCGTGGACATGTGGT pXPR_003 CGG 583 19% 10 0.8527 CDKL5 CDKL5 77197
4 BRDN0001144796 AAGAATGATATTGTCCATCG pXPR_003 AGG 398 13% 7 0.6492 CDKL5 CDKL5 77198
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368312 CAGAGTCGGCATAGCTATATT pLKO_005 1639 CDS 100% 15.000 21.000 N CDKL5 n/a
2 TRCN0000023097 CCTATGGAGTTGTACTTAAAT pLKO.1 317 CDS 100% 15.000 21.000 N Cdkl5 n/a
3 TRCN0000368296 CCTATGGAGTTGTACTTAAAT pLKO_005 317 CDS 100% 15.000 21.000 N CDKL5 n/a
4 TRCN0000355700 GATATTGTCCATCGAGATATA pLKO_005 637 CDS 100% 13.200 18.480 N CDKL5 n/a
5 TRCN0000196341 GCCTATGGAGTTGTACTTAAA pLKO.1 316 CDS 100% 13.200 18.480 N CDKL5 n/a
6 TRCN0000002014 GGAAGAACCAATTAACACCAA pLKO.1 3392 3UTR 100% 2.640 2.112 N CDKL5 n/a
7 TRCN0000195512 CAGCCACAATGATGTCCTAAA pLKO.1 678 CDS 100% 10.800 7.560 N CDKL5 n/a
8 TRCN0000002012 GTGGAGTTGAAGGAAGCATTT pLKO.1 466 CDS 100% 10.800 7.560 N CDKL5 n/a
9 TRCN0000002013 CTACATCTATCAGCTAATCAA pLKO.1 591 CDS 100% 5.625 3.938 N CDKL5 n/a
10 TRCN0000002011 ACATCTCTCTTCGGCCTCAAA pLKO.1 2778 CDS 100% 4.950 3.465 N CDKL5 n/a
11 TRCN0000195433 CATGAAATTGTGGCGATCAAG pLKO.1 355 CDS 100% 4.950 3.465 N CDKL5 n/a
12 TRCN0000023098 CCAGACAATTCTTTCCATGAA pLKO.1 2416 CDS 100% 4.950 3.465 N Cdkl5 n/a
13 TRCN0000002015 CGACAGAACAACAAGGAGAAT pLKO.1 3032 CDS 100% 4.950 3.465 N CDKL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14852 pDONR223 65.7% 79.3% 21.8% None (many diffs) n/a
2 ccsbBroad304_14852 pLX_304 0% 79.3% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV