Transcript: Mouse NM_001037744.1

Mus musculus translocase of inner mitochondrial membrane 8A2 (Timm8a2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Timm8a2 (223262)
Length:
946
CDS:
14..307

Additional Resources:

NCBI RefSeq record:
NM_001037744.1
NBCI Gene record:
Timm8a2 (223262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252200 AGGGTTTCGGATCCGTCTATT pLKO_005 352 3UTR 100% 13.200 18.480 N Timm8a2 n/a
2 TRCN0000252199 AGTTGCTCATCCACCACATGA pLKO_005 111 CDS 100% 4.950 3.960 N Timm8a2 n/a
3 TRCN0000252201 GAGACCACTCTTCTCAGAAAG pLKO_005 274 CDS 100% 10.800 7.560 N Timm8a2 n/a
4 TRCN0000252197 TCCGACTGATCTCAGCGTTTC pLKO_005 299 CDS 100% 6.000 4.200 N Timm8a2 n/a
5 TRCN0000252198 ATACGAGCCAGTTCATCTTGA pLKO_005 228 CDS 100% 4.950 2.970 N Timm8a2 n/a
6 TRCN0000063980 CCAGTTCATCTTGAATCGACT pLKO.1 235 CDS 100% 2.640 1.584 N TIMM8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.