Transcript: Mouse NM_001037764.1

Mus musculus retinoic acid induced 1 (Rai1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rai1 (19377)
Length:
7125
CDS:
306..5975

Additional Resources:

NCBI RefSeq record:
NM_001037764.1
NBCI Gene record:
Rai1 (19377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328266 AGCCTGAAATCCGACTCAAAT pLKO_005 4927 CDS 100% 13.200 18.480 N Rai1 n/a
2 TRCN0000124987 CTCGCCAAGTACCAACACTAT pLKO.1 1176 CDS 100% 4.950 6.930 N Rai1 n/a
3 TRCN0000328334 ACCATCTCGTGCTCCTATAAA pLKO_005 5847 CDS 100% 15.000 12.000 N Rai1 n/a
4 TRCN0000328262 ATAAGAGGCTGCCGTTGTAAT pLKO_005 5956 CDS 100% 13.200 9.240 N Rai1 n/a
5 TRCN0000014663 GCCTCGTTATATAGTGTATAT pLKO.1 6895 3UTR 100% 13.200 9.240 N RAI1 n/a
6 TRCN0000328336 TCCCTACCTCCTCCACTTATG pLKO_005 931 CDS 100% 10.800 7.560 N Rai1 n/a
7 TRCN0000124986 CGAGATGCTTACACCACCATA pLKO.1 5022 CDS 100% 4.950 3.465 N Rai1 n/a
8 TRCN0000328264 TGAGGCCTAGGTTGCGAAGAA pLKO_005 6074 3UTR 100% 4.950 3.465 N Rai1 n/a
9 TRCN0000124988 GCCAAGTACCAACACTATGGA pLKO.1 1179 CDS 100% 3.000 2.100 N Rai1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14054 pDONR223 100% 41.1% 42% None (many diffs) n/a
2 ccsbBroad304_14054 pLX_304 0% 41.1% 42% V5 (many diffs) n/a
3 TRCN0000492271 GACGCAACCAAAGTCATCCTTGGT pLX_317 14.4% 41.1% 42% V5 (many diffs) n/a
Download CSV