Transcript: Human NM_001037954.4

Homo sapiens DIX domain containing 1 (DIXDC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
DIXDC1 (85458)
Length:
5826
CDS:
158..2209

Additional Resources:

NCBI RefSeq record:
NM_001037954.4
NBCI Gene record:
DIXDC1 (85458)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431918 GCAAAGAGCGAGTCCATTATA pLKO_005 842 CDS 100% 15.000 21.000 N DIXDC1 n/a
2 TRCN0000134516 GAACTCAAGTAGGTAGTGAAT pLKO.1 1866 CDS 100% 4.950 6.930 N DIXDC1 n/a
3 TRCN0000425515 AGAGCTACTGAGGGCAAATAT pLKO_005 1327 CDS 100% 15.000 10.500 N DIXDC1 n/a
4 TRCN0000138927 GCAGGGATCATTCTGGGTAAA pLKO.1 3282 3UTR 100% 10.800 7.560 N DIXDC1 n/a
5 TRCN0000137219 GCTATTGATCGGGAAGGAAAT pLKO.1 2054 CDS 100% 10.800 7.560 N DIXDC1 n/a
6 TRCN0000137860 GAGCGAGAGCTAGAACACAAA pLKO.1 1532 CDS 100% 4.950 3.465 N DIXDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09267 pDONR223 100% 68.6% 67.9% None (many diffs) n/a
2 ccsbBroad304_09267 pLX_304 0% 68.6% 67.9% V5 (many diffs) n/a
3 TRCN0000480287 CACCAATGGAACCAATAGCGAGGA pLX_317 26.6% 68.6% 67.9% V5 (many diffs) n/a
Download CSV