Transcript: Mouse NM_001038602.4

Mus musculus MARVEL (membrane-associating) domain containing 2 (Marveld2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Marveld2 (218518)
Length:
3061
CDS:
62..1729

Additional Resources:

NCBI RefSeq record:
NM_001038602.4
NBCI Gene record:
Marveld2 (218518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241706 AGCTTAGGTTAGCGTTAAATT pLKO_005 2897 3UTR 100% 15.000 21.000 N Marveld2 n/a
2 TRCN0000241704 TGACGATCGAGAACGCTATAA pLKO_005 1408 CDS 100% 13.200 18.480 N Marveld2 n/a
3 TRCN0000197682 CCAGTCAAACAATTAACCAAT pLKO.1 2500 3UTR 100% 4.950 6.930 N Marveld2 n/a
4 TRCN0000241705 GTTATCCCTAGACACTGTTTA pLKO_005 1719 CDS 100% 13.200 10.560 N Marveld2 n/a
5 TRCN0000244340 ATACGATAAAGTGATGAATTG pLKO_005 1687 CDS 100% 10.800 7.560 N Marveld2 n/a
6 TRCN0000217371 GCGATTACCTCAAGAACAAAC pLKO.1 1638 CDS 100% 10.800 7.560 N Marveld2 n/a
7 TRCN0000241703 GCGATTACCTCAAGAACAAAC pLKO_005 1638 CDS 100% 10.800 7.560 N Marveld2 n/a
8 TRCN0000216409 GAATACGATAAAGTGATGAAT pLKO.1 1685 CDS 100% 5.625 3.938 N Marveld2 n/a
9 TRCN0000217570 GAAGAATGACCCTTCGTTTCT pLKO.1 1600 CDS 100% 4.950 3.465 N Marveld2 n/a
10 TRCN0000072634 GCTGCAATGATCTTCCTGTTT pLKO.1 1079 CDS 100% 4.950 3.465 N MARVELD2 n/a
11 TRCN0000072635 GCAGCCATAGTCTATGTGAAT pLKO.1 971 CDS 100% 4.950 3.465 N MARVELD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09697 pDONR223 100% 84.3% 86.9% None (many diffs) n/a
2 ccsbBroad304_09697 pLX_304 0% 84.3% 86.9% V5 (many diffs) n/a
3 TRCN0000477522 TGAATCCGATGGTTCACACTTACC pLX_317 24.4% 84.3% 86.9% V5 (many diffs) n/a
Download CSV