Transcript: Human NM_001038704.4

Homo sapiens septin 4 (SEPTIN4), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SEPTIN4 (5414)
Length:
2086
CDS:
143..1855

Additional Resources:

NCBI RefSeq record:
NM_001038704.4
NBCI Gene record:
SEPTIN4 (5414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001038704.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282743 CAGGTCCTTACGGTCCAATTC pLKO_005 891 CDS 100% 10.800 15.120 N n/a
2 TRCN0000263658 TGATGGTGTACACCGAGTTTC pLKO_005 985 CDS 100% 10.800 15.120 N n/a
3 TRCN0000263657 TGGGTCGTTTAGGAGATAAAT pLKO_005 1837 CDS 100% 15.000 10.500 N n/a
4 TRCN0000263659 ATTTCACCATTAGAGTCATTT pLKO_005 1907 3UTR 100% 13.200 9.240 N n/a
5 TRCN0000282745 GGGTCTGAGGTTACTACTAAC pLKO_005 194 CDS 100% 10.800 7.560 N n/a
6 TRCN0000181109 CCTGAAGAAGCAGAGGAACTT pLKO.1 1871 3UTR 100% 4.950 2.970 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038704.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09951 pDONR223 100% 99.8% 99.8% None 189A>G;262C>A n/a
2 ccsbBroad304_09951 pLX_304 0% 99.8% 99.8% V5 189A>G;262C>A n/a
3 TRCN0000465614 CCCGACAGTAGCACTCATTGCTGG pLX_317 21.6% 99.8% 99.8% V5 189A>G;262C>A n/a
Download CSV