Transcript: Human NM_001038705.3

Homo sapiens G protein-coupled receptor 149 (GPR149), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
GPR149 (344758)
Length:
5527
CDS:
576..2771

Additional Resources:

NCBI RefSeq record:
NM_001038705.3
NBCI Gene record:
GPR149 (344758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001038705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253758 CTCCAGCTCCTACGTACTATT pLKO_005 1133 CDS 100% 13.200 18.480 N GPR149 n/a
2 TRCN0000253754 ATCCGCCAGGAACCCTGAATA pLKO_005 655 CDS 100% 13.200 10.560 N GPR149 n/a
3 TRCN0000253755 TAGCACATGAAGATTACTATG pLKO_005 1810 CDS 100% 10.800 8.640 N GPR149 n/a
4 TRCN0000253756 GTAATCCTGATGGTGATATTA pLKO_005 2611 CDS 100% 15.000 10.500 N GPR149 n/a
5 TRCN0000360251 TGTGGAAAGAGAATCATAATT pLKO_005 619 CDS 100% 15.000 10.500 N GPR149 n/a
6 TRCN0000360250 ATTTCCCGTGGAGCTTCAATT pLKO_005 1269 CDS 100% 13.200 9.240 N GPR149 n/a
7 TRCN0000253757 GGGAGTGGTGTAGGAGTAAAT pLKO_005 2158 CDS 100% 13.200 9.240 N GPR149 n/a
8 TRCN0000360187 GCGACTCTCCTAGTCTCTTAC pLKO_005 942 CDS 100% 10.800 7.560 N GPR149 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488287 GCTGGCTCTCGGAGGGTTAACGTC pLX_317 11.2% 100% 100% V5 n/a
2 TRCN0000489609 TTACCAAAACCGGGTCTTAGAGGC pLX_317 18% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV