Transcript: Mouse NM_001039094.3

Mus musculus neuronal growth regulator 1 (Negr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Negr1 (320840)
Length:
5002
CDS:
402..1448

Additional Resources:

NCBI RefSeq record:
NM_001039094.3
NBCI Gene record:
Negr1 (320840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113669 GCTCAACAGGTCAAGTATCAT pLKO.1 596 CDS 100% 5.625 7.875 N Negr1 n/a
2 TRCN0000113668 GCGCCTACAATTCAGGAAATT pLKO.1 1053 CDS 100% 13.200 10.560 N Negr1 n/a
3 TRCN0000113666 CGCCTACAATTCAGGAAATTA pLKO.1 1054 CDS 100% 15.000 10.500 N Negr1 n/a
4 TRCN0000113667 CGAGTGGTACAAAGGAGAGAA pLKO.1 1148 CDS 100% 4.950 3.465 N Negr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13482 pDONR223 100% 57.7% 61.4% None (many diffs) n/a
2 ccsbBroad304_13482 pLX_304 0% 57.7% 61.4% V5 (many diffs) n/a
3 TRCN0000475198 CATTAACTGAATTATCAAAAGAAC pLX_317 79.9% 57.7% 61.4% V5 (many diffs) n/a
Download CSV