Transcript: Human NM_001039141.3

Homo sapiens TRIO and F-actin binding protein (TRIOBP), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TRIOBP (11078)
Length:
10085
CDS:
212..7309

Additional Resources:

NCBI RefSeq record:
NM_001039141.3
NBCI Gene record:
TRIOBP (11078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117085 CTCGGACTCTAACAAGGAGAA pLKO.1 5902 CDS 100% 4.050 5.670 N TRIOBP n/a
2 TRCN0000288921 CTCGGACTCTAACAAGGAGAA pLKO_005 5902 CDS 100% 4.050 5.670 N TRIOBP n/a
3 TRCN0000117084 CATTGGTTTGTGCTGACAGAT pLKO.1 5639 CDS 100% 4.950 3.465 N TRIOBP n/a
4 TRCN0000090843 CCTTGCACCTTCTTCAGGATT pLKO.1 7570 3UTR 100% 4.950 3.465 N Triobp n/a
5 TRCN0000335330 CCTTGCACCTTCTTCAGGATT pLKO_005 7570 3UTR 100% 4.950 3.465 N Triobp n/a
6 TRCN0000117083 GCTGACAGATTCAAGTCTCAA pLKO.1 5650 CDS 100% 4.950 3.465 N TRIOBP n/a
7 TRCN0000288920 GCTGACAGATTCAAGTCTCAA pLKO_005 5650 CDS 100% 4.950 3.465 N TRIOBP n/a
8 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 9091 3UTR 100% 4.050 2.025 Y P3H4 n/a
9 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 9091 3UTR 100% 4.050 2.025 Y ORAI2 n/a
10 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 9091 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7434 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 7452 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.