Transcript: Human NM_001039199.3

Homo sapiens alpha tocopherol transfer protein like (TTPAL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TTPAL (79183)
Length:
6224
CDS:
134..1162

Additional Resources:

NCBI RefSeq record:
NM_001039199.3
NBCI Gene record:
TTPAL (79183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149418 CGAGCCATATACTTGACCTTA pLKO.1 620 CDS 100% 4.950 6.930 N TTPAL n/a
2 TRCN0000147790 GCACCTTAACTGAATCATGTA pLKO.1 1715 3UTR 100% 4.950 6.930 N TTPAL n/a
3 TRCN0000149296 GCCAGTGAGAACTACTTGTAT pLKO.1 1548 3UTR 100% 5.625 3.938 N TTPAL n/a
4 TRCN0000148751 CAGACTACAAAGGAGTGAGTT pLKO.1 693 CDS 100% 4.950 3.465 N TTPAL n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2437 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5563 3UTR 100% 4.950 2.475 Y DCAF11 n/a
7 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 2595 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04068 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04068 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477495 CAATTCCTTCCACCCTTGCTGATA pLX_317 38.4% 100% 100% V5 n/a
Download CSV