Transcript: Human NM_001039372.4

Homo sapiens HEPACAM family member 2 (HEPACAM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
HEPACAM2 (253012)
Length:
2145
CDS:
24..1412

Additional Resources:

NCBI RefSeq record:
NM_001039372.4
NBCI Gene record:
HEPACAM2 (253012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039372.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144069 CATGCAGAATAGAGGCATTTA pLKO.1 1545 3UTR 100% 13.200 18.480 N HEPACAM2 n/a
2 TRCN0000144417 CCAGATCATATGGCTATTTGA pLKO.1 215 CDS 100% 0.000 0.000 N HEPACAM2 n/a
3 TRCN0000145498 GAGGACTGACAATACTACATA pLKO.1 875 CDS 100% 5.625 3.938 N HEPACAM2 n/a
4 TRCN0000143821 GCATCAGACATCCAGATCATA pLKO.1 204 CDS 100% 5.625 3.938 N HEPACAM2 n/a
5 TRCN0000142756 CCAGAAGACAATGGACTATGT pLKO.1 944 CDS 100% 4.950 3.465 N HEPACAM2 n/a
6 TRCN0000121952 CCTCTTACTCATTATTCCTTT pLKO.1 1523 3UTR 100% 4.950 3.465 N HEPACAM2 n/a
7 TRCN0000141550 CGGTTGATGATCCTGTCACAA pLKO.1 445 CDS 100% 4.950 3.465 N HEPACAM2 n/a
8 TRCN0000143364 GCAGGCAAGATGAAACTCATT pLKO.1 991 CDS 100% 4.950 3.465 N HEPACAM2 n/a
9 TRCN0000142529 GCCCAGAAGACAATGGACTAT pLKO.1 942 CDS 100% 4.950 3.465 N HEPACAM2 n/a
10 TRCN0000142755 CAGAAGATACAAGTCACGGTT pLKO.1 429 CDS 100% 2.640 1.848 N HEPACAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039372.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09892 pDONR223 100% 96.5% 93.1% None (many diffs) n/a
2 ccsbBroad304_09892 pLX_304 0% 96.5% 93.1% V5 (many diffs) n/a
3 TRCN0000475924 GCTTCAGACGATGTCCCAGACCTA pLX_317 23.8% 96.5% 93.1% V5 (many diffs) n/a
Download CSV