Transcript: Human NM_001039614.2

Homo sapiens inhibitory synaptic factor 1 (INSYN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
INSYN1 (388135)
Length:
5730
CDS:
346..1227

Additional Resources:

NCBI RefSeq record:
NM_001039614.2
NBCI Gene record:
INSYN1 (388135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264022 CTGACTACCGCCTCATGAATG pLKO_005 755 CDS 100% 10.800 15.120 N INSYN1 n/a
2 TRCN0000264024 GGACTTCATGACAGCCGATAT pLKO_005 639 CDS 100% 10.800 15.120 N INSYN1 n/a
3 TRCN0000264023 TAACCTCGGACTTCGACTTTG pLKO_005 524 CDS 100% 10.800 15.120 N INSYN1 n/a
4 TRCN0000282902 GGTGGTGAGCCAGATCGATAA pLKO_005 501 CDS 100% 10.800 8.640 N INSYN1 n/a
5 TRCN0000264021 ACACAGCCACTAGACAGAAAG pLKO_005 1190 CDS 100% 10.800 7.560 N INSYN1 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2663 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 5332 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05573 pDONR223 100% 99.8% 100% None 357T>C n/a
2 ccsbBroad304_05573 pLX_304 0% 99.8% 100% V5 357T>C n/a
3 TRCN0000478013 TGTGGCGTTCTCAATCAAGCTGTG pLX_317 25.9% 99.8% 100% V5 357T>C n/a
Download CSV