Transcript: Mouse NM_001039723.2

Mus musculus transmembrane protein 120B (Tmem120b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem120b (330189)
Length:
1860
CDS:
153..1172

Additional Resources:

NCBI RefSeq record:
NM_001039723.2
NBCI Gene record:
Tmem120b (330189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265391 GTGTCGATTTGTCCTTCATTA pLKO_005 590 CDS 100% 13.200 18.480 N Tmem120b n/a
2 TRCN0000253427 CCTGTCCCAGCTCCCTATTTA pLKO_005 1371 3UTR 100% 15.000 10.500 N Tmem120b n/a
3 TRCN0000253426 CTTGGCCTAATGGACTAATTT pLKO_005 766 CDS 100% 15.000 10.500 N Tmem120b n/a
4 TRCN0000253429 AGCTCTACCTGACCATAATTC pLKO_005 550 CDS 100% 13.200 9.240 N Tmem120b n/a
5 TRCN0000253428 CAGTTTCTACAGTACTATTAC pLKO_005 840 CDS 100% 13.200 9.240 N Tmem120b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04972 pDONR223 100% 88.9% 94.3% None (many diffs) n/a
2 ccsbBroad304_04972 pLX_304 0% 88.9% 94.3% V5 (many diffs) n/a
3 TRCN0000475722 TTGTGTATCCTCCCTATATCATTT pLX_317 34% 88.9% 94.3% V5 (many diffs) n/a
Download CSV