Transcript: Human NM_001040143.2

Homo sapiens sodium voltage-gated channel alpha subunit 2 (SCN2A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SCN2A (6326)
Length:
8895
CDS:
398..6415

Additional Resources:

NCBI RefSeq record:
NM_001040143.2
NBCI Gene record:
SCN2A (6326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435342 AGACGATAGGAACCAATTTAA pLKO_005 6680 3UTR 100% 15.000 21.000 N SCN2A n/a
2 TRCN0000418816 TAAGCGTGTTTGCGCTAATAG pLKO_005 1173 CDS 100% 13.200 18.480 N SCN2A n/a
3 TRCN0000044387 GCATATTTAACTGGGATGAAT pLKO.1 1332 CDS 100% 5.625 7.875 N SCN2A n/a
4 TRCN0000044383 GCTGCTAAAGTGGGTTGCATA pLKO.1 4168 CDS 100% 4.950 3.465 N SCN2A n/a
5 TRCN0000044384 GCTGCTATTGAACAACGCATT pLKO.1 464 CDS 100% 4.050 2.835 N SCN2A n/a
6 TRCN0000044385 GCTCTCATTGAGAGCAATCAA pLKO.1 4559 CDS 100% 0.563 0.394 N SCN2A n/a
7 TRCN0000044386 GCCTTTGTTAGGAAGCAGAAA pLKO.1 3479 CDS 100% 4.950 2.970 N SCN2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.