Transcript: Human NM_001040199.1

Homo sapiens claudin domain containing 1 (CLDND1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CLDND1 (56650)
Length:
2500
CDS:
544..1305

Additional Resources:

NCBI RefSeq record:
NM_001040199.1
NBCI Gene record:
CLDND1 (56650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148001 GACAATGTATCCGGTGAATTT pLKO.1 1159 CDS 100% 13.200 18.480 N CLDND1 n/a
2 TRCN0000343284 GACAATGTATCCGGTGAATTT pLKO_005 1159 CDS 100% 13.200 18.480 N CLDND1 n/a
3 TRCN0000147882 GTACACCTTAATGAAGGCATA pLKO.1 1272 CDS 100% 4.050 3.240 N CLDND1 n/a
4 TRCN0000343235 GTACACCTTAATGAAGGCATA pLKO_005 1272 CDS 100% 4.050 3.240 N CLDND1 n/a
5 TRCN0000146505 CCGGAAAGAGTACACCTTAAT pLKO.1 1263 CDS 100% 13.200 9.240 N CLDND1 n/a
6 TRCN0000352823 CCGGAAAGAGTACACCTTAAT pLKO_005 1263 CDS 100% 13.200 9.240 N CLDND1 n/a
7 TRCN0000175111 GAAAGAGTACACCTTAATGAA pLKO.1 1266 CDS 100% 5.625 3.938 N Cldnd1 n/a
8 TRCN0000292788 GAAAGAGTACACCTTAATGAA pLKO_005 1266 CDS 100% 5.625 3.938 N Cldnd1 n/a
9 TRCN0000149054 GCACAGACTTCTGGTATGAAT pLKO.1 626 CDS 100% 5.625 3.938 N CLDND1 n/a
10 TRCN0000343283 GCACAGACTTCTGGTATGAAT pLKO_005 626 CDS 100% 5.625 3.938 N CLDND1 n/a
11 TRCN0000146451 CCAGCAGTATTAGTGCTGTTT pLKO.1 1749 3UTR 100% 0.495 0.347 N CLDND1 n/a
12 TRCN0000352824 CCAGCAGTATTAGTGCTGTTT pLKO_005 1749 3UTR 100% 0.495 0.347 N CLDND1 n/a
13 TRCN0000174466 CAGAGTCATTTGATGTGGTTA pLKO.1 833 CDS 100% 4.950 3.465 N Cldnd1 n/a
14 TRCN0000292714 CAGAGTCATTTGATGTGGTTA pLKO_005 833 CDS 100% 4.950 3.465 N Cldnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03731 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03731 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465354 TGCGAGTGCCCGGAAGGCCCCTTA pLX_317 46.3% 100% 100% V5 n/a
Download CSV