Transcript: Mouse NM_001040699.1

Mus musculus myotubularin related protein 7 (Mtmr7), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Mtmr7 (54384)
Length:
3446
CDS:
72..2054

Additional Resources:

NCBI RefSeq record:
NM_001040699.1
NBCI Gene record:
Mtmr7 (54384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001040699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030030 CCGGACTCTGAAAGGATTCAT pLKO.1 1151 CDS 100% 5.625 4.500 N Mtmr7 n/a
2 TRCN0000030029 GCCCTTTCCTACTACTGTAAA pLKO.1 639 CDS 100% 13.200 9.240 N Mtmr7 n/a
3 TRCN0000030031 CCAGTAATCGACCAGTTCATT pLKO.1 1260 CDS 100% 5.625 3.938 N Mtmr7 n/a
4 TRCN0000030032 GCTTGGTAGACAGAGTGTCTT pLKO.1 109 CDS 100% 4.950 3.465 N Mtmr7 n/a
5 TRCN0000030033 GCTATGAGAATGAAGACAATT pLKO.1 838 CDS 100% 13.200 7.920 N Mtmr7 n/a
6 TRCN0000146728 CCTTTGGAGTTCCAAAGTAAA pLKO.1 2060 3UTR 100% 1.320 0.792 N MTMR7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07361 pDONR223 100% 88.9% 94.5% None (many diffs) n/a
2 ccsbBroad304_07361 pLX_304 0% 88.9% 94.5% V5 (many diffs) n/a
3 TRCN0000465949 GCTCGAGCGTCCCAGCTTCGCACC pLX_317 14% 88.9% 94.5% V5 (many diffs) n/a
4 ccsbBroadEn_15656 pDONR223 0% 88.9% 94.5% None (many diffs) n/a
5 ccsbBroad304_15656 pLX_304 0% 88.9% 94.5% V5 (many diffs) n/a
6 TRCN0000465507 CTAAAGTGTTCGTGTCGTCAGGAT pLX_317 14% 88.8% 94.5% V5 (many diffs) n/a
7 ccsbBroadEn_14929 pDONR223 92.3% 88.7% 94.3% None (many diffs) n/a
8 ccsbBroad304_14929 pLX_304 0% 88.7% 94.3% V5 (many diffs) n/a
Download CSV