Transcript: Human NM_001042402.2

Homo sapiens N-acylethanolamine acid amidase (NAAA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NAAA (27163)
Length:
1732
CDS:
65..1036

Additional Resources:

NCBI RefSeq record:
NM_001042402.2
NBCI Gene record:
NAAA (27163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049511 TCCGTGTTCTGCACCAGTATT pLKO.1 431 CDS 100% 13.200 18.480 N NAAA n/a
2 TRCN0000290339 TCCGTGTTCTGCACCAGTATT pLKO_005 431 CDS 100% 13.200 18.480 N NAAA n/a
3 TRCN0000049509 CATGGTCGGAATTTGGATTAT pLKO.1 482 CDS 100% 13.200 9.240 N NAAA n/a
4 TRCN0000307174 CATGGTCGGAATTTGGATTAT pLKO_005 482 CDS 100% 13.200 9.240 N NAAA n/a
5 TRCN0000049512 CGGCATGTGTGACTTCATGAA pLKO.1 364 CDS 100% 4.950 3.465 N NAAA n/a
6 TRCN0000290272 CGGCATGTGTGACTTCATGAA pLKO_005 364 CDS 100% 4.950 3.465 N NAAA n/a
7 TRCN0000049508 GCCCACACAAGTTTACAGTTT pLKO.1 618 CDS 100% 4.950 3.465 N NAAA n/a
8 TRCN0000290270 GCCCACACAAGTTTACAGTTT pLKO_005 618 CDS 100% 4.950 3.465 N NAAA n/a
9 TRCN0000049510 GCGGCACTACGACTTGGACTT pLKO.1 220 CDS 100% 1.350 0.945 N NAAA n/a
10 TRCN0000290337 GCGGCACTACGACTTGGACTT pLKO_005 220 CDS 100% 1.350 0.945 N NAAA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11853 pDONR223 100% 61.6% 60.9% None 591_622del;627_632delGTTTCG;636_969del n/a
2 ccsbBroad304_11853 pLX_304 0% 61.6% 60.9% V5 591_622del;627_632delGTTTCG;636_969del n/a
3 TRCN0000473150 CAACAATCGTTTAGCGGTACACCT pLX_317 72.2% 61.6% 60.9% V5 591_622del;627_632delGTTTCG;636_969del n/a
Download CSV