Transcript: Human NM_001042427.3

Homo sapiens chromosome 10 open reading frame 53 (C10orf53), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
C10orf53 (282966)
Length:
3259
CDS:
48..329

Additional Resources:

NCBI RefSeq record:
NM_001042427.3
NBCI Gene record:
C10orf53 (282966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042427.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135830 CATGGTGAATGAAGAAGTCAT pLKO.1 212 CDS 100% 4.950 3.960 N C10orf53 n/a
2 TRCN0000133780 CAACATTAAGGACTTGGAGTT pLKO.1 242 CDS 100% 4.050 2.835 N C10orf53 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2657 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042427.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09932 pDONR223 100% 52.5% 48.1% None (many diffs) n/a
2 ccsbBroad304_09932 pLX_304 0% 52.5% 48.1% V5 (many diffs) n/a
3 TRCN0000478860 GTCAGTGCAGGGATTAACGTATAA pLX_317 76.9% 52.5% 48.1% V5 (many diffs) n/a
Download CSV