Transcript: Human NM_001042572.3

Homo sapiens chromodomain helicase DNA binding protein 2 (CHD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CHD2 (1106)
Length:
2232
CDS:
573..2078

Additional Resources:

NCBI RefSeq record:
NM_001042572.3
NBCI Gene record:
CHD2 (1106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236471 CAAGAACCATCGCGATTTAAT pLKO_005 921 CDS 100% 15.000 21.000 N CHD2 n/a
2 TRCN0000021335 GCCTCTAAGAAGGAACGGATA pLKO.1 831 CDS 100% 4.050 5.670 N CHD2 n/a
3 TRCN0000021334 CCCTCAAATGAGCCCGAATAT pLKO.1 1791 CDS 100% 13.200 9.240 N CHD2 n/a
4 TRCN0000236469 CCTCAAATGAGCCCGAATATC pLKO_005 1792 CDS 100% 13.200 9.240 N CHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00301 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00301 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466626 GAGAGAACCATGAACGTTGCGATT pLX_317 23.9% 100% 100% V5 n/a
Download CSV