Transcript: Human NM_001042588.1

Homo sapiens snurportin 1 (SNUPN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SNUPN (10073)
Length:
1503
CDS:
146..1228

Additional Resources:

NCBI RefSeq record:
NM_001042588.1
NBCI Gene record:
SNUPN (10073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038570 CCAGACTGATTTCCGATTCTA pLKO.1 742 CDS 100% 5.625 4.500 N SNUPN n/a
2 TRCN0000296180 ATGCTTTCTGAGTGGTTAATT pLKO_005 452 CDS 100% 15.000 10.500 N SNUPN n/a
3 TRCN0000296181 GGATGCCTCATGGAGAATTAA pLKO_005 1208 CDS 100% 15.000 10.500 N SNUPN n/a
4 TRCN0000038569 GCTGGAAACAGCTTATCTATA pLKO.1 1349 3UTR 100% 13.200 9.240 N SNUPN n/a
5 TRCN0000289218 GCTGGAAACAGCTTATCTATA pLKO_005 1349 3UTR 100% 13.200 9.240 N SNUPN n/a
6 TRCN0000038571 GCCTGTGTGATGTGCTATCTA pLKO.1 867 CDS 100% 5.625 3.938 N SNUPN n/a
7 TRCN0000289296 GCCTGTGTGATGTGCTATCTA pLKO_005 867 CDS 100% 5.625 3.938 N SNUPN n/a
8 TRCN0000198359 GCTTTCTGAGTGGTTAATTGA pLKO.1 454 CDS 100% 5.625 3.938 N Snupn n/a
9 TRCN0000038573 GATTGCATTTACAATGAGGTA pLKO.1 662 CDS 100% 2.640 1.848 N SNUPN n/a
10 TRCN0000038572 CACTGTCAAGAAGTTACCAAA pLKO.1 412 CDS 100% 4.950 2.970 N SNUPN n/a
11 TRCN0000289294 CACTGTCAAGAAGTTACCAAA pLKO_005 412 CDS 100% 4.950 2.970 N SNUPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02304 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02304 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474119 GTCGATAACATGGTTGCAACCATG pLX_317 37.9% 100% 100% V5 n/a
Download CSV