Transcript: Mouse NM_001042707.2

Mus musculus interleukin enhancer binding factor 3 (Ilf3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ilf3 (16201)
Length:
3564
CDS:
325..3021

Additional Resources:

NCBI RefSeq record:
NM_001042707.2
NBCI Gene record:
Ilf3 (16201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066794 GCATGGCAAGAACCCTGTTAT pLKO.1 1893 CDS 100% 13.200 18.480 N Ilf3 n/a
2 TRCN0000304447 CTACTGAGCAGGGACCGATTT pLKO_005 1865 CDS 100% 10.800 15.120 N Ilf3 n/a
3 TRCN0000066797 CGGTGGACTACACTGTTCAAA pLKO.1 1379 CDS 100% 5.625 7.875 N Ilf3 n/a
4 TRCN0000014580 GCCAGATGGTTCTGGCATTTA pLKO.1 1179 CDS 100% 1.320 1.848 N ILF3 n/a
5 TRCN0000304446 TGTTAGTTACCATTACGTAAA pLKO_005 3237 3UTR 100% 10.800 8.640 N Ilf3 n/a
6 TRCN0000066793 CCCTGTTGTCAGAGAAGAAAT pLKO.1 843 CDS 100% 13.200 9.240 N Ilf3 n/a
7 TRCN0000304445 GAACTACCAGTACAGATAAAG pLKO_005 3003 CDS 100% 13.200 9.240 N Ilf3 n/a
8 TRCN0000374151 GAATGCCCTGATGAGGTTAAA pLKO_005 1533 CDS 100% 13.200 9.240 N Ilf3 n/a
9 TRCN0000374204 CCAACTTGTCTCGGGAGATTG pLKO_005 3066 3UTR 100% 10.800 7.560 N Ilf3 n/a
10 TRCN0000066796 GCTGTCTCTGACTGGATTGAT pLKO.1 454 CDS 100% 5.625 3.938 N Ilf3 n/a
11 TRCN0000316045 GCTGTCTCTGACTGGATTGAT pLKO_005 454 CDS 100% 5.625 3.938 N Ilf3 n/a
12 TRCN0000066795 GCAAAGGCTTATGCTGCACTT pLKO.1 2050 CDS 100% 4.050 2.835 N Ilf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06449 pDONR223 100% 67.4% 73% None (many diffs) n/a
2 ccsbBroad304_06449 pLX_304 0% 67.4% 73% V5 (many diffs) n/a
3 TRCN0000467740 TATGAGTATTCTCCACCACAGTTG pLX_317 17.9% 67.4% 73% V5 (many diffs) n/a
Download CSV