Transcript: Human NM_001042724.2

Homo sapiens nectin cell adhesion molecule 2 (NECTIN2), transcript variant delta, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
NECTIN2 (5819)
Length:
2690
CDS:
230..1846

Additional Resources:

NCBI RefSeq record:
NM_001042724.2
NBCI Gene record:
NECTIN2 (5819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063077 GCACCTGCGAACCACCAGAAT pLKO.1 452 CDS 100% 1.650 1.155 N NECTIN2 n/a
2 TRCN0000063075 GCCCAGGATGTGCGAGTTCAA pLKO.1 320 CDS 100% 1.650 1.155 N NECTIN2 n/a
3 TRCN0000063074 CAGGTCATCTTTGTCCGAGAA pLKO.1 1253 CDS 100% 4.050 5.670 N NECTIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01350 pDONR223 100% 78.2% 70.8% None (many diffs) n/a
2 ccsbBroad304_01350 pLX_304 0% 78.2% 70.8% V5 (many diffs) n/a
3 TRCN0000469677 AGATTCCCTGAACCCCTTAGAACC pLX_317 32.2% 78.2% 70.8% V5 (many diffs) n/a
Download CSV