Transcript: Mouse NM_001044308.2

Mus musculus calcium channel, voltage-dependent, alpha 1I subunit (Cacna1i), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cacna1i (239556)
Length:
9833
CDS:
562..7161

Additional Resources:

NCBI RefSeq record:
NM_001044308.2
NBCI Gene record:
Cacna1i (239556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001044308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238504 ATCATGCGTGTTCTGCGTATT pLKO_005 5194 CDS 100% 10.800 15.120 N Cacna1i n/a
2 TRCN0000069991 CCTCACGGTGTCTAACTACAT pLKO.1 4047 CDS 100% 4.950 6.930 N Cacna1i n/a
3 TRCN0000069540 CTACTGTGAGTGACACGTCTT pLKO.1 6521 CDS 100% 4.050 5.670 N LOC383074 n/a
4 TRCN0000069903 CGTGATGGATGCACATTCTTT pLKO.1 1650 CDS 100% 5.625 4.500 N LOC383073 n/a
5 TRCN0000238507 TACCAGCCATGTGACGATATG pLKO_005 850 CDS 100% 0.000 0.000 N Cacna1i n/a
6 TRCN0000238506 ATCCTGTGTCAGACCATTATT pLKO_005 3919 CDS 100% 15.000 10.500 N Cacna1i n/a
7 TRCN0000238503 CCTGGTAAGATGAGCTATAAA pLKO_005 9052 3UTR 100% 15.000 10.500 N Cacna1i n/a
8 TRCN0000069992 CTGGGTGAACATCATGTATAA pLKO.1 4581 CDS 100% 13.200 9.240 N Cacna1i n/a
9 TRCN0000238505 AGCTATGATCAGCGATCTTTG pLKO_005 3316 CDS 100% 10.800 7.560 N Cacna1i n/a
10 TRCN0000044169 GAGGAGAACTTCACCATACAA pLKO.1 1279 CDS 100% 5.625 3.938 N CACNA1I n/a
11 TRCN0000044172 CAGCGTCTCTTTAATCATCAA pLKO.1 5904 CDS 100% 4.950 3.465 N CACNA1I n/a
12 TRCN0000069989 CCGCAAGATGATTGATGTGTA pLKO.1 3828 CDS 100% 4.950 3.465 N Cacna1i n/a
13 TRCN0000069538 CCTGTCACTCACATCTCTCTT pLKO.1 6879 CDS 100% 4.950 3.465 N LOC383074 n/a
14 TRCN0000069904 CTTCCAATATGTCTGTCACAT pLKO.1 1869 CDS 100% 4.950 3.465 N LOC383073 n/a
15 TRCN0000069990 CCAATACCCATGACACCCAAT pLKO.1 3148 CDS 100% 4.050 2.835 N Cacna1i n/a
16 TRCN0000069907 CTCAAAGCCATCAACCGTGTT pLKO.1 1111 CDS 100% 4.050 2.835 N LOC383073 n/a
17 TRCN0000069541 CCAGCCAGGAAGTTCAGCAGT pLKO.1 6937 CDS 100% 0.880 0.616 N LOC383074 n/a
18 TRCN0000069542 CGTGGCCTGTTTAGTCTGCGT pLKO.1 6706 CDS 100% 0.220 0.154 N LOC383074 n/a
19 TRCN0000069905 GTACCAGCCATGTGACGATAT pLKO.1 849 CDS 100% 0.000 0.000 N LOC383073 n/a
20 TRCN0000044238 GCCATCAACTTTGACAACATT pLKO.1 1564 CDS 100% 5.625 2.813 Y CACNA1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.