Transcript: Mouse NM_001045527.1

Mus musculus heat shock transcription factor family member 5 (Hsf5), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hsf5 (327992)
Length:
4158
CDS:
109..1983

Additional Resources:

NCBI RefSeq record:
NM_001045527.1
NBCI Gene record:
Hsf5 (327992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238651 CGGTCATTCCGGCGAGATAAT pLKO_005 769 CDS 100% 13.200 18.480 N Hsf5 n/a
2 TRCN0000238654 CTCCGTCTTCAGTAGTATTTG pLKO_005 1685 CDS 100% 13.200 18.480 N Hsf5 n/a
3 TRCN0000238653 AGTACTCCCAAGCCTACTATC pLKO_005 1091 CDS 100% 10.800 15.120 N Hsf5 n/a
4 TRCN0000238652 CCCAAAGGAGGAGGAGTTAAA pLKO_005 1956 CDS 100% 13.200 9.240 N Hsf5 n/a
5 TRCN0000238650 TTGCAGAGTGGAAGGATTAAA pLKO_005 2801 3UTR 100% 15.000 9.000 N Hsf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13106 pDONR223 100% 69% 68.3% None (many diffs) n/a
2 ccsbBroad304_13106 pLX_304 0% 69% 68.3% V5 (many diffs) n/a
3 TRCN0000469247 ACCTCAGAATGCCGACACAAGTCC pLX_317 31.9% 69% 68.3% V5 (many diffs) n/a
Download CSV