Transcript: Human NM_001045556.3

Homo sapiens Src like adaptor (SLA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLA (6503)
Length:
2995
CDS:
369..1199

Additional Resources:

NCBI RefSeq record:
NM_001045556.3
NBCI Gene record:
SLA (6503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001045556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078693 CCCGGTACTTTATTCTAAGAA pLKO.1 2326 3UTR 100% 5.625 7.875 N SLA n/a
2 TRCN0000078696 CCTCCTTTGATCGAAAGAAGA pLKO.1 1102 CDS 100% 4.950 6.930 N SLA n/a
3 TRCN0000430478 GCCCTGAATGGAACTACTTTA pLKO_005 1663 3UTR 100% 13.200 10.560 N SLA n/a
4 TRCN0000078697 AGAGAGTTACATCCCTGGAAT pLKO.1 572 CDS 100% 4.950 3.960 N SLA n/a
5 TRCN0000436491 AGTTACACTCCAAGGTCATTG pLKO_005 1558 3UTR 100% 10.800 7.560 N SLA n/a
6 TRCN0000078695 CACCTCCTTTGATCGAAAGAA pLKO.1 1100 CDS 100% 5.625 3.938 N SLA n/a
7 TRCN0000418415 GGGCTGGTGGAAAGCTATTTC pLKO_005 536 CDS 100% 13.200 7.920 N SLA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06953 pDONR223 100% 99.8% 100% None 324C>T n/a
2 ccsbBroad304_06953 pLX_304 0% 99.8% 100% V5 324C>T n/a
3 TRCN0000474019 TCGCTGATGCGTAGGCGGACCCCC pLX_317 46.2% 99.8% 100% V5 324C>T n/a
Download CSV