Transcript: Mouse NM_001048217.3

Mus musculus serine peptidase inhibitor, Kazal type 11 (Spink11), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Spink11 (433181)
Length:
746
CDS:
1..345

Additional Resources:

NCBI RefSeq record:
NM_001048217.3
NBCI Gene record:
Spink11 (433181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001048217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087166 TGTACCTTGTATAAGAGTGAA pLKO.1 190 CDS 100% 4.950 6.930 N Spink11 n/a
2 TRCN0000087163 CCAATGTGAACCTGAGATTAA pLKO.1 467 3UTR 100% 13.200 9.240 N Spink11 n/a
3 TRCN0000087134 GCCAAATTGTACCTTGTATAA pLKO.1 183 CDS 100% 13.200 9.240 N Spink11 n/a
4 TRCN0000087133 GCGTAGAGAAGATTAAAGAAT pLKO.1 442 3UTR 100% 5.625 3.938 N Spink11 n/a
5 TRCN0000087165 TCTGCCTAGAACAATTAGTAT pLKO.1 281 CDS 100% 5.625 3.938 N Spink11 n/a
6 TRCN0000087135 GCATGTTACTTCTGCCTAGAA pLKO.1 271 CDS 100% 4.950 3.465 N Spink11 n/a
7 TRCN0000087167 AGTAAGCACAGAGTGCTGGTA pLKO.1 27 CDS 100% 2.640 1.848 N Spink11 n/a
8 TRCN0000087137 CTTTGGTACTTCTTCCTTATT pLKO.1 116 CDS 100% 13.200 7.920 N Spink11 n/a
9 TRCN0000087164 GTGCCAAATTGTACCTTGTAT pLKO.1 181 CDS 100% 5.625 3.375 N Spink11 n/a
10 TRCN0000087136 GTCCTCAACATGGATCAAATT pLKO.1 81 CDS 100% 13.200 6.600 Y Spink11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001048217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.