Transcript: Human NM_001048222.2

Homo sapiens dysbindin domain containing 2 (DBNDD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
DBNDD2 (55861)
Length:
1263
CDS:
205..543

Additional Resources:

NCBI RefSeq record:
NM_001048222.2
NBCI Gene record:
DBNDD2 (55861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001048222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152283 CTGGAGCAAGTAGAACTTATT pLKO.1 388 CDS 100% 13.200 6.600 Y DBNDD2 n/a
2 TRCN0000343977 CTGGAGCAAGTAGAACTTATT pLKO_005 388 CDS 100% 13.200 6.600 Y DBNDD2 n/a
3 TRCN0000156116 CATAGCCCAAATCCAAGTGAT pLKO.1 684 3UTR 100% 4.950 2.475 Y DBNDD2 n/a
4 TRCN0000344046 CATAGCCCAAATCCAAGTGAT pLKO_005 684 3UTR 100% 4.950 2.475 Y DBNDD2 n/a
5 TRCN0000156956 GATGCAGCAGATGTGTTCTTG pLKO.1 424 CDS 100% 4.950 2.475 Y DBNDD2 n/a
6 TRCN0000156355 CCAAGTGATGATGGAGCAGAT pLKO.1 696 3UTR 100% 4.050 2.025 Y DBNDD2 n/a
7 TRCN0000155823 CCAAATCCAAGTGATGATGGA pLKO.1 690 3UTR 100% 2.640 1.320 Y DBNDD2 n/a
8 TRCN0000157259 GATGTGTTCTTGCCTTGCGAA pLKO.1 433 CDS 100% 2.640 1.320 Y DBNDD2 n/a
9 TRCN0000353033 GATGTGTTCTTGCCTTGCGAA pLKO_005 433 CDS 100% 2.640 1.320 Y DBNDD2 n/a
10 TRCN0000155668 CCAGAGACAGAGTTTGTCTTT pLKO.1 289 CDS 100% 0.495 0.248 Y DBNDD2 n/a
11 TRCN0000343976 CCAGAGACAGAGTTTGTCTTT pLKO_005 289 CDS 100% 0.495 0.248 Y DBNDD2 n/a
12 TRCN0000182730 GCAGATGTGTTCTTGCCTTGT pLKO.1 430 CDS 100% 4.050 2.025 Y Dbndd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001048222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08601 pDONR223 100% 64.4% 59.6% None (many diffs) n/a
2 ccsbBroad304_08601 pLX_304 0% 64.4% 59.6% V5 (many diffs) n/a
3 TRCN0000478588 GCATTTCCCTGGCCCAACACTCAG pLX_317 76.9% 64.4% 59.6% V5 (many diffs) n/a
Download CSV