Transcript: Mouse NM_001076789.1

Mus musculus chromobox 5 (Cbx5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Cbx5 (12419)
Length:
8801
CDS:
131..706

Additional Resources:

NCBI RefSeq record:
NM_001076789.1
NBCI Gene record:
Cbx5 (12419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001076789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071049 GCGCTGATGATATTAAATCTA pLKO.1 420 CDS 100% 5.625 7.875 N Cbx5 n/a
2 TRCN0000316373 GCGCTGATGATATTAAATCTA pLKO_005 420 CDS 100% 5.625 7.875 N Cbx5 n/a
3 TRCN0000071048 CCCTCATATTTAGACTGTATT pLKO.1 1513 3UTR 100% 13.200 10.560 N Cbx5 n/a
4 TRCN0000316374 CCCTCATATTTAGACTGTATT pLKO_005 1513 3UTR 100% 13.200 10.560 N Cbx5 n/a
5 TRCN0000071051 CGGTGACTTAATGTTCTTAAT pLKO.1 529 CDS 100% 13.200 9.240 N Cbx5 n/a
6 TRCN0000316375 CGGTGACTTAATGTTCTTAAT pLKO_005 529 CDS 100% 13.200 9.240 N Cbx5 n/a
7 TRCN0000071052 CCTGAACTAATTTCTGAGTTT pLKO.1 308 CDS 100% 4.950 3.465 N Cbx5 n/a
8 TRCN0000349186 CCTGAACTAATTTCTGAGTTT pLKO_005 308 CDS 100% 4.950 3.465 N Cbx5 n/a
9 TRCN0000071050 CCACAGATTGTGATAGCATTT pLKO.1 611 CDS 100% 10.800 6.480 N Cbx5 n/a
10 TRCN0000316443 CCACAGATTGTGATAGCATTT pLKO_005 611 CDS 100% 10.800 6.480 N Cbx5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001076789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.