Transcript: Human NM_001077195.2

Homo sapiens zinc finger protein 436 (ZNF436), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZNF436 (80818)
Length:
4465
CDS:
532..1944

Additional Resources:

NCBI RefSeq record:
NM_001077195.2
NBCI Gene record:
ZNF436 (80818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230524 AGTTGTGGGCCACGATTTAAA pLKO_005 2046 3UTR 100% 15.000 21.000 N ZNF436 n/a
2 TRCN0000230522 CAGGCATCCGCTATCATATAT pLKO_005 929 CDS 100% 15.000 21.000 N ZNF436 n/a
3 TRCN0000018021 GCAGGAGCTCAGCTCTTATTA pLKO.1 1898 CDS 100% 15.000 10.500 N ZNF436 n/a
4 TRCN0000230521 AGGAGTGAGAACGAGGTAAAT pLKO_005 703 CDS 100% 13.200 9.240 N ZNF436 n/a
5 TRCN0000230523 GTCGCAGCTCACACCTTATTC pLKO_005 1058 CDS 100% 13.200 9.240 N ZNF436 n/a
6 TRCN0000018019 CCCAAGCAAGAGATTAGTGAA pLKO.1 724 CDS 100% 4.950 3.465 N ZNF436 n/a
7 TRCN0000018020 CGCTATCATATATGTTCTCAT pLKO.1 937 CDS 100% 4.950 3.465 N ZNF436 n/a
8 TRCN0000018018 CGGGATGTTATGCAGGAGAAT pLKO.1 649 CDS 100% 4.950 3.465 N ZNF436 n/a
9 TRCN0000018022 CCTGAAAGTGAAGAGGGCTTT pLKO.1 799 CDS 100% 4.050 2.835 N ZNF436 n/a
10 TRCN0000218771 AGTCAGATCTCAGACCTTAAT pLKO_005 973 CDS 100% 13.200 7.920 N ZNF436 n/a
11 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1681 CDS 100% 6.000 3.000 Y Zfp612 n/a
12 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1685 CDS 100% 5.625 2.813 Y ZNF625 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09050 pDONR223 100% 99.9% 100% None 942T>C n/a
2 ccsbBroad304_09050 pLX_304 0% 99.9% 100% V5 942T>C n/a
3 TRCN0000469825 CCAGTTAGTCTTTGTTTATCATAT pLX_317 35.3% 99.9% 100% V5 942T>C n/a
Download CSV