Transcript: Mouse NM_001077267.2

Mus musculus heterogeneous nuclear ribonucleoprotein D (Hnrnpd), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpd (11991)
Length:
6607
CDS:
315..1178

Additional Resources:

NCBI RefSeq record:
NM_001077267.2
NBCI Gene record:
Hnrnpd (11991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103735 CCTGAATGGAAGTATGACGTT pLKO.1 1304 3UTR 100% 2.640 3.696 N Hnrnpd n/a
2 TRCN0000324352 CCTGAATGGAAGTATGACGTT pLKO_005 1304 3UTR 100% 2.640 3.696 N Hnrnpd n/a
3 TRCN0000103737 CGGAGAGTGTAGATAAGGTCA pLKO.1 700 CDS 100% 2.640 3.696 N Hnrnpd n/a
4 TRCN0000324423 CGGAGAGTGTAGATAAGGTCA pLKO_005 700 CDS 100% 2.640 3.696 N Hnrnpd n/a
5 TRCN0000103738 CACAATGTTGGTCTTAGTAAA pLKO.1 990 CDS 100% 13.200 9.240 N Hnrnpd n/a
6 TRCN0000324351 CACAATGTTGGTCTTAGTAAA pLKO_005 990 CDS 100% 13.200 9.240 N Hnrnpd n/a
7 TRCN0000103736 AGAGTGGTTATGGGAAAGTAT pLKO.1 1117 CDS 100% 5.625 3.938 N Hnrnpd n/a
8 TRCN0000324355 AGAGTGGTTATGGGAAAGTAT pLKO_005 1117 CDS 100% 5.625 3.938 N Hnrnpd n/a
9 TRCN0000001294 AGTAAGAACGAGGAGGATGAA pLKO.1 525 CDS 100% 4.950 3.465 N HNRNPD n/a
10 TRCN0000293352 AGTAAGAACGAGGAGGATGAA pLKO_005 525 CDS 100% 4.950 3.465 N HNRNPD n/a
11 TRCN0000103739 GAAAGATCTGAAGGACTACTT pLKO.1 587 CDS 100% 4.950 3.465 N Hnrnpd n/a
12 TRCN0000324354 GAAAGATCTGAAGGACTACTT pLKO_005 587 CDS 100% 4.950 3.465 N Hnrnpd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15451 pDONR223 0% 88% 91.2% None (many diffs) n/a
2 ccsbBroad304_15451 pLX_304 0% 88% 91.2% V5 (many diffs) n/a
3 TRCN0000468850 CCTGTTACTTTTTATATGGGTCTG pLX_317 42.6% 88% 91.2% V5 (many diffs) n/a
4 ccsbBroadEn_00766 pDONR223 98.6% 75.9% 78.3% None (many diffs) n/a
5 ccsbBroad304_00766 pLX_304 0% 75.9% 78.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV