Transcript: Human NM_001077628.3

Homo sapiens aph-1 homolog A, gamma-secretase subunit (APH1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
APH1A (51107)
Length:
1730
CDS:
207..1004

Additional Resources:

NCBI RefSeq record:
NM_001077628.3
NBCI Gene record:
APH1A (51107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330369 CATGGAGACTCACCCTATTAC pLKO_005 654 CDS 100% 13.200 18.480 N APH1A n/a
2 TRCN0000165575 GTTCCGCTTTGCCTACTACAA pLKO.1 461 CDS 100% 4.950 6.930 N APH1A n/a
3 TRCN0000162102 CACCCTATTACTTCCTGACTT pLKO.1 664 CDS 100% 4.950 3.960 N APH1A n/a
4 TRCN0000330435 GTCTTCTCTGTTATCAATATT pLKO_005 597 CDS 100% 15.000 10.500 N APH1A n/a
5 TRCN0000166729 CCATGGAGACTCACCCTATTA pLKO.1 653 CDS 100% 13.200 9.240 N APH1A n/a
6 TRCN0000113339 CTTTCTGACAGCAGCCATTAT pLKO.1 689 CDS 100% 13.200 9.240 N Aph1a n/a
7 TRCN0000330368 TGCCTACTACAAGCTGCTTAA pLKO_005 470 CDS 100% 10.800 7.560 N APH1A n/a
8 TRCN0000160758 CCATCTATGCAGTCACTGTTT pLKO.1 853 CDS 100% 4.950 3.465 N APH1A n/a
9 TRCN0000330366 CCATCTATGCAGTCACTGTTT pLKO_005 853 CDS 100% 4.950 3.465 N APH1A n/a
10 TRCN0000113336 CGGTATCATCAGTGGTGTCTT pLKO.1 581 CDS 100% 4.950 3.465 N Aph1a n/a
11 TRCN0000161423 GAACTGGCATTACTGGAACTA pLKO.1 1430 3UTR 100% 4.950 3.465 N APH1A n/a
12 TRCN0000330367 GAACTGGCATTACTGGAACTA pLKO_005 1430 3UTR 100% 4.950 3.465 N APH1A n/a
13 TRCN0000166089 GTCTGGTTCATCTTGGTCCAT pLKO.1 360 CDS 100% 2.640 1.848 N APH1A n/a
14 TRCN0000162474 CAGTGGTGTCTTCTCTGTTAT pLKO.1 590 CDS 100% 13.200 7.920 N APH1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03209 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03209 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478734 TGCCGGCGGATTATGACCTCGTAC pLX_317 53.2% 100% 100% V5 n/a
4 ccsbBroadEn_15821 pDONR223 0% 99.8% 99.6% None 706C>A n/a
5 ccsbBroad304_15821 pLX_304 0% 99.8% 99.6% V5 706C>A n/a
6 TRCN0000467983 AGATCAGACCGCTCGTATACAGAT pLX_317 36.9% 99.8% 99.6% V5 706C>A n/a
7 ccsbBroadEn_03208 pDONR223 100% 92.9% 92.4% None 735_745delinsTA;751_795del n/a
8 ccsbBroad304_03208 pLX_304 0% 92.9% 92.4% V5 735_745delinsTA;751_795del n/a
9 TRCN0000470640 ATCTGATAACATCCGTCACTGCGA pLX_317 55.8% 92.9% 92.4% V5 735_745delinsTA;751_795del n/a
Download CSV