Transcript: Mouse NM_001077631.2

Mus musculus integrator complex subunit 14 (Ints14), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ints14 (69882)
Length:
2896
CDS:
469..2016

Additional Resources:

NCBI RefSeq record:
NM_001077631.2
NBCI Gene record:
Ints14 (69882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200484 CGACTCTTCATGTCTCAATTA pLKO.1 2290 3UTR 100% 13.200 18.480 N Ints14 n/a
2 TRCN0000200610 CCCTTTGTTATAGATGAAGAA pLKO.1 1165 CDS 100% 4.950 2.970 N Ints14 n/a
3 TRCN0000191353 CCCTTTCCCATCTAAGTTATA pLKO.1 906 CDS 100% 13.200 6.600 Y Ints14 n/a
4 TRCN0000200497 CCCATCTAAGTTATATGTCAT pLKO.1 912 CDS 100% 4.950 2.475 Y Ints14 n/a
5 TRCN0000182917 CAAGAAGAAATCAAACCTCAT pLKO.1 1494 CDS 100% 4.050 2.025 Y 6330549D23Rik n/a
6 TRCN0000179176 GACTTGGAAATAGTGGGCTTT pLKO.1 1216 CDS 100% 4.050 2.025 Y 6330549D23Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09071 pDONR223 100% 90% 97.4% None (many diffs) n/a
2 ccsbBroad304_09071 pLX_304 0% 90% 97.4% V5 (many diffs) n/a
3 TRCN0000471372 CAAACGTAGTTTTACTCTATAGTT pLX_317 28.7% 90% 97.4% V5 (many diffs) n/a
Download CSV