Transcript: Human NM_001077653.2

Homo sapiens T-box transcription factor 20 (TBX20), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TBX20 (57057)
Length:
1824
CDS:
481..1824

Additional Resources:

NCBI RefSeq record:
NM_001077653.2
NBCI Gene record:
TBX20 (57057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017015 CTGGATCAACATGGCCATATA pLKO.1 1117 CDS 100% 13.200 18.480 N TBX20 n/a
2 TRCN0000017013 GCGACGGAGAACACAATCAAA pLKO.1 580 CDS 100% 5.625 7.875 N TBX20 n/a
3 TRCN0000017016 TGAGCAACTACTCAAACAGAT pLKO.1 1059 CDS 100% 4.950 3.960 N TBX20 n/a
4 TRCN0000415010 AGCCAAGGGTGCACATCATTA pLKO_005 1163 CDS 100% 13.200 9.240 N TBX20 n/a
5 TRCN0000017014 CCAAGGAGCTTTGGGACAAAT pLKO.1 797 CDS 100% 13.200 9.240 N TBX20 n/a
6 TRCN0000414457 ATCCTGAGGCCAAGTACATAG pLKO_005 902 CDS 100% 10.800 7.560 N TBX20 n/a
7 TRCN0000017017 CCCAGTGAGGAAATGGCCAAA pLKO.1 757 CDS 100% 4.050 2.835 N TBX20 n/a
8 TRCN0000412851 CCTCATTGCTCAACCTGAAGT pLKO_005 1202 CDS 100% 4.950 2.970 N TBX20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08694 pDONR223 100% 66.3% 66.4% None 39T>C;892_1341del n/a
2 ccsbBroad304_08694 pLX_304 0% 66.3% 66.4% V5 39T>C;892_1341del n/a
3 TRCN0000491446 ACCTAACCTAACTACGCTTGAACG pLX_317 43.8% 66.3% 66.4% V5 39T>C;892_1341del n/a
Download CSV