Transcript: Human NM_001079675.5

Homo sapiens ETS variant transcription factor 4 (ETV4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ETV4 (2118)
Length:
2335
CDS:
208..1662

Additional Resources:

NCBI RefSeq record:
NM_001079675.5
NBCI Gene record:
ETV4 (2118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079675.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273971 AGCGTTACGTGTACAAGTTTG pLKO_005 1448 CDS 100% 10.800 15.120 N ETV4 n/a
2 TRCN0000013933 CCCTGTGTACATATAAATGAA pLKO.1 1701 3UTR 100% 5.625 4.500 N ETV4 n/a
3 TRCN0000273927 CCCTGTGTACATATAAATGAA pLKO_005 1701 3UTR 100% 5.625 4.500 N ETV4 n/a
4 TRCN0000013935 GCTCCGATACTATTATGAGAA pLKO.1 1401 CDS 100% 4.950 3.960 N ETV4 n/a
5 TRCN0000013937 CCAGGATCTAAGTCACTTCCA pLKO.1 369 CDS 100% 2.640 2.112 N ETV4 n/a
6 TRCN0000273925 CCAGGATCTAAGTCACTTCCA pLKO_005 369 CDS 100% 2.640 2.112 N ETV4 n/a
7 TRCN0000013934 GCAGAGCTTTAAGCAAGAATA pLKO.1 873 CDS 100% 13.200 9.240 N ETV4 n/a
8 TRCN0000273928 CTACACCTTCAGCAGCAAATC pLKO_005 252 CDS 100% 10.800 7.560 N ETV4 n/a
9 TRCN0000273924 GAATGGAGTTCAAGCTCATTG pLKO_005 1304 CDS 100% 10.800 7.560 N ETV4 n/a
10 TRCN0000013936 CCCAACAAATGCCCATTTCAT pLKO.1 1266 CDS 100% 5.625 3.375 N ETV4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079675.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10810 pDONR223 100% 42.7% 42.7% None 1_831del n/a
2 ccsbBroad304_10810 pLX_304 0% 42.7% 42.7% V5 1_831del n/a
3 TRCN0000470102 ATAGCCTCATCACGTTTCCTCCGA pLX_317 66.6% 42.7% 42.7% V5 1_831del n/a
Download CSV