Transcript: Human NM_001080414.4

Homo sapiens coiled-coil domain containing 88C (CCDC88C), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CCDC88C (440193)
Length:
7519
CDS:
131..6217

Additional Resources:

NCBI RefSeq record:
NM_001080414.4
NBCI Gene record:
CCDC88C (440193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254712 ATCGAGCTGGAGCGGAATAAT pLKO_005 3308 CDS 100% 15.000 21.000 N CCDC88C n/a
2 TRCN0000254714 GGGTTCGAGGGAACGCTTAAA pLKO_005 4390 CDS 100% 13.200 18.480 N CCDC88C n/a
3 TRCN0000265600 CAATGTGTTGAGCTCCGTTAA pLKO_005 6562 3UTR 100% 10.800 15.120 N CCDC88C n/a
4 TRCN0000190721 GATTTAGTGGACGGCATCTTT pLKO.1 248 CDS 100% 5.625 7.875 N Ccdc88c n/a
5 TRCN0000254713 CCACAAATCAACGCATCAATA pLKO_005 303 CDS 100% 13.200 9.240 N CCDC88C n/a
6 TRCN0000254715 CGAGCCTAAATCGCCAGTTAG pLKO_005 3099 CDS 100% 10.800 7.560 N CCDC88C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13687 pDONR223 100% 24.8% 24.7% None (many diffs) n/a
2 ccsbBroad304_13687 pLX_304 0% 24.8% 24.7% V5 (many diffs) n/a
3 TRCN0000480142 GGCGGGAGTAGTTCCTACGTATCC pLX_317 27.8% 24.8% 24.7% V5 (many diffs) n/a
Download CSV