Transcript: Human NM_001080497.3

Homo sapiens multiple EGF like domains 9 (MEGF9), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
MEGF9 (1955)
Length:
6300
CDS:
113..1921

Additional Resources:

NCBI RefSeq record:
NM_001080497.3
NBCI Gene record:
MEGF9 (1955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055587 CGAGGGAAATTGCATCAAGAA pLKO.1 1447 CDS 100% 4.950 3.960 N MEGF9 n/a
2 TRCN0000307669 CGAGGGAAATTGCATCAAGAA pLKO_005 1447 CDS 100% 4.950 3.960 N MEGF9 n/a
3 TRCN0000055584 GCATTCCCAATGCAGATGTTT pLKO.1 1815 CDS 100% 5.625 3.938 N MEGF9 n/a
4 TRCN0000291337 GCATTCCCAATGCAGATGTTT pLKO_005 1815 CDS 100% 5.625 3.938 N MEGF9 n/a
5 TRCN0000055585 CGAACTGCAATAAATGTGAAA pLKO.1 1254 CDS 100% 4.950 3.465 N MEGF9 n/a
6 TRCN0000291336 CGAACTGCAATAAATGTGAAA pLKO_005 1254 CDS 100% 4.950 3.465 N MEGF9 n/a
7 TRCN0000055583 CGAGTGAATTGGAACCTGAAT pLKO.1 1203 CDS 100% 4.950 3.465 N MEGF9 n/a
8 TRCN0000307671 CGAGTGAATTGGAACCTGAAT pLKO_005 1203 CDS 100% 4.950 3.465 N MEGF9 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4829 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000438356 CAACCCTGCAGACTATCTTTG pLKO_005 1572 CDS 100% 10.800 7.560 N Megf9 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4830 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.