Transcript: Human NM_001080791.3

Homo sapiens coiled-coil domain containing 32 (CCDC32), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CCDC32 (90416)
Length:
1905
CDS:
263..847

Additional Resources:

NCBI RefSeq record:
NM_001080791.3
NBCI Gene record:
CCDC32 (90416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167375 GAAGTGTATTTAGCATCTCTA pLKO.1 512 CDS 100% 4.950 6.930 N CCDC32 n/a
2 TRCN0000282742 AGGATCTCTGGGCTGAAATTT pLKO_005 336 CDS 100% 15.000 10.500 N CCDC32 n/a
3 TRCN0000263649 TAAGTTAAGTGAGCCATATAT pLKO_005 1225 3UTR 100% 15.000 10.500 N CCDC32 n/a
4 TRCN0000263651 TGAGAGCACCTTGGAACATTT pLKO_005 685 CDS 100% 13.200 9.240 N CCDC32 n/a
5 TRCN0000263650 TGCAGGATTCAGAAGTGTATT pLKO_005 501 CDS 100% 13.200 9.240 N CCDC32 n/a
6 TRCN0000181827 GAGCACCTTGGAACATTTCAA pLKO.1 688 CDS 100% 5.625 3.938 N Ccdc32 n/a
7 TRCN0000172934 GCTGGGCTTCTTTCTCTCATT pLKO.1 1409 3UTR 100% 4.950 3.465 N CCDC32 n/a
8 TRCN0000200455 GATGAGAGCACCTTGGAACAT pLKO.1 683 CDS 100% 4.950 2.970 N Ccdc32 n/a
9 TRCN0000168370 GAGTTCTTTGTGGATGGACTT pLKO.1 656 CDS 100% 4.050 2.430 N CCDC32 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 852 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04516 pDONR223 100% 95.3% 95.3% None 1_27del n/a
2 ccsbBroad304_04516 pLX_304 0% 95.3% 95.3% V5 1_27del n/a
3 TRCN0000470236 GAACGGCCGGACAGTTGTGGCTTT pLX_317 78% 95.3% 95.3% V5 1_27del n/a
Download CSV