Transcript: Mouse NM_001080795.2

Mus musculus GTPase activating protein (SH3 domain) binding protein 2 (G3bp2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
G3bp2 (23881)
Length:
4226
CDS:
241..1590

Additional Resources:

NCBI RefSeq record:
NM_001080795.2
NBCI Gene record:
G3bp2 (23881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218983 GAATAAAGCTCCCGAGTATTT pLKO_005 309 CDS 100% 13.200 18.480 N G3bp2 n/a
2 TRCN0000096807 CAACCGGAGAATAATTCGCTA pLKO.1 1101 CDS 100% 2.640 3.696 N G3bp2 n/a
3 TRCN0000225868 AGCTCCAGTGTGAACTATAAA pLKO_005 2756 3UTR 100% 15.000 12.000 N G3bp2 n/a
4 TRCN0000225866 GACTCTGACAACCGGAGAATA pLKO_005 1093 CDS 100% 13.200 10.560 N G3bp2 n/a
5 TRCN0000096805 CCAATTATGTTTCGAGGAGAA pLKO.1 1318 CDS 100% 4.050 3.240 N G3bp2 n/a
6 TRCN0000225865 GGAGTTTGTGAGGCAATATTA pLKO_005 279 CDS 100% 15.000 10.500 N G3bp2 n/a
7 TRCN0000414061 TAAATTGAGGTGGACATTATT pLKO_005 1728 3UTR 100% 15.000 10.500 N G3BP2 n/a
8 TRCN0000047548 CGGGAGTTTGTGAGGCAATAT pLKO.1 277 CDS 100% 13.200 9.240 N G3BP2 n/a
9 TRCN0000225867 TTCGAGGAGAAGTACGTTTAA pLKO_005 1328 CDS 100% 13.200 9.240 N G3bp2 n/a
10 TRCN0000417055 CACAATGATATGTTTCGTTAT pLKO_005 619 CDS 100% 10.800 7.560 N G3BP2 n/a
11 TRCN0000096808 GAATGCTAACAGCGCTTACTA pLKO.1 747 CDS 100% 5.625 3.938 N G3bp2 n/a
12 TRCN0000096804 AGTTAAATTGAGGTGGACATT pLKO.1 1725 3UTR 100% 4.950 3.465 N G3bp2 n/a
13 TRCN0000047549 CGCATCAATACCAAGGGTGTT pLKO.1 1222 CDS 100% 4.050 2.835 N G3BP2 n/a
14 TRCN0000096806 GCTGAATAAAGCTCCCGAGTA pLKO.1 306 CDS 100% 4.050 2.835 N G3bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02268 pDONR223 100% 92.7% 98.2% None (many diffs) n/a
2 ccsbBroad304_02268 pLX_304 0% 92.7% 98.2% V5 (many diffs) n/a
3 TRCN0000472215 AGCCGACTAAACAGTACAAATATG pLX_317 16.4% 92.7% 98.2% V5 (many diffs) n/a
Download CSV