Transcript: Mouse NM_001081054.2

Mus musculus glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 (Qrsl1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Qrsl1 (76563)
Length:
1970
CDS:
100..1677

Additional Resources:

NCBI RefSeq record:
NM_001081054.2
NBCI Gene record:
Qrsl1 (76563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253317 GTTTCACGGCACGGCCTTATT pLKO_005 733 CDS 100% 13.200 18.480 N Qrsl1 n/a
2 TRCN0000253316 ATCAGAAGAGGTCGCTTTAAA pLKO_005 228 CDS 100% 15.000 12.000 N Qrsl1 n/a
3 TRCN0000253315 GAGACAACATGTGCATCAAAT pLKO_005 352 CDS 100% 13.200 10.560 N Qrsl1 n/a
4 TRCN0000045373 GCATCGAATATGGCAAGATTT pLKO.1 1093 CDS 100% 13.200 10.560 N QRSL1 n/a
5 TRCN0000253318 TCAGAAGTAGCATCGAATATG pLKO_005 1084 CDS 100% 13.200 9.240 N Qrsl1 n/a
6 TRCN0000253314 GGTAGGATGCTGGGATCTTAC pLKO_005 1703 3UTR 100% 10.800 7.560 N Qrsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03570 pDONR223 100% 83.3% 87.9% None (many diffs) n/a
2 ccsbBroad304_03570 pLX_304 0% 83.3% 87.9% V5 (many diffs) n/a
3 TRCN0000468988 CCCAGCACAAGAAGTGTACGATCA pLX_317 29.8% 83.3% 87.9% V5 (many diffs) n/a
Download CSV